View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1990_high_5 (Length: 264)
Name: NF1990_high_5
Description: NF1990
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1990_high_5 |
 | |
|
Alignment Details
Target: chr8 (Bit Score: 68; Significance: 2e-30; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 68; E-Value: 2e-30
Query Start/End: Original strand, 28 - 128
Target Start/End: Original strand, 14171143 - 14171241
Alignment:
| Q |
28 |
gaagtgatgatggattggattaatacgttaaagaaaggctataatgtgaat-aaacgttcattcacgactataataatgtttggacttcggacgttacgt |
126 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||| | | |||| ||||||||||||||| |||||||||||||||||||||||||||||||| |
|
|
| T |
14171143 |
gaagtgatgatggattggattaatacgttaaagaaaggcttt---gggaattaaacgttcattcacggctataataatgtttggacttcggacgttacgt |
14171239 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University