View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1990_low_3 (Length: 363)
Name: NF1990_low_3
Description: NF1990
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1990_low_3 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 157; Significance: 2e-83; HSPs: 2)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 157; E-Value: 2e-83
Query Start/End: Original strand, 195 - 359
Target Start/End: Original strand, 18110477 - 18110641
Alignment:
| Q |
195 |
cttatgagtcaagcaagaatcaaaacttagaagaaaaggaagttgaaaaagcagaaccttctgctccaaatgttccagagaaggaaaaggaatcttgctg |
294 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
18110477 |
cttatgagtcaagcaagaatcaaaacttagaagaaaaggaagttgaaaaagcagaaccttctgctccaaatgttccagagaaggaaaaggaatcttgctg |
18110576 |
T |
 |
| Q |
295 |
cagaattcctccaaatcaagaaggaaagaatggaatcagaaaatttgctgctacttcatctcagt |
359 |
Q |
| |
|
|||||||||||| |||||||||||||||||||||||||||||||||||||||||||| ||||||| |
|
|
| T |
18110577 |
cagaattcctcccaatcaagaaggaaagaatggaatcagaaaatttgctgctacttcttctcagt |
18110641 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 113; E-Value: 4e-57
Query Start/End: Original strand, 17 - 133
Target Start/End: Original strand, 18110299 - 18110415
Alignment:
| Q |
17 |
accaaaacacaaacaaatgaaaaggctcaaaagggtgaagaggaagtagaaccaaaaacaatagagaaattggttaccaaagaaaatttagaggaaaaga |
116 |
Q |
| |
|
|||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
18110299 |
accaaagcacaaacaaatgaaaaggctcaaaagggtgaagaggaagtagaaccaaaaacaatagagaaattggttaccaaagaaaatttagaggaaaaga |
18110398 |
T |
 |
| Q |
117 |
tagtaggaatgagtgct |
133 |
Q |
| |
|
||||||||||||||||| |
|
|
| T |
18110399 |
tagtaggaatgagtgct |
18110415 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University