View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF19910_low_11 (Length: 246)
Name: NF19910_low_11
Description: NF19910
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF19910_low_11 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 209; Significance: 1e-114; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 209; E-Value: 1e-114
Query Start/End: Original strand, 24 - 232
Target Start/End: Complemental strand, 47194106 - 47193898
Alignment:
| Q |
24 |
tgaagaagcatctccactacttgactcatggatggtctttcattcatgtcatctttcacacacatcaaagccactttaaccaaattctcaacctgattaa |
123 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
47194106 |
tgaagaagcatctccactacttgactcatggatggtctttcattcatgtcatctttcacacacatcaaagccactttaaccaaattctcaacctgattaa |
47194007 |
T |
 |
| Q |
124 |
catcatattttccttccaaattaccatcaacaatctcttcaatccaaaacatagtcgtaggtgcacttttcaccttttccatcacccaactcaccattcg |
223 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
47194006 |
catcatattttccttccaaattaccatcaacaatctcttcaatccaaaacatagtcgtaggtgcacttttcaccttttccatcacccaactcaccattcg |
47193907 |
T |
 |
| Q |
224 |
atgatgatg |
232 |
Q |
| |
|
||||||||| |
|
|
| T |
47193906 |
atgatgatg |
47193898 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University