View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF19910_low_12 (Length: 245)

Name: NF19910_low_12
Description: NF19910
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF19910_low_12
NF19910_low_12
[»] chr8 (1 HSPs)
chr8 (19-230)||(29552318-29552529)
[»] chr7 (1 HSPs)
chr7 (143-189)||(17293020-17293066)


Alignment Details
Target: chr8 (Bit Score: 184; Significance: 1e-99; HSPs: 1)
Name: chr8
Description:

Target: chr8; HSP #1
Raw Score: 184; E-Value: 1e-99
Query Start/End: Original strand, 19 - 230
Target Start/End: Original strand, 29552318 - 29552529
Alignment:
19 attacaggacaggtgctatagatctggaaaatagaatactgaaccagaaggatttggcaggcaacactattttgcacatttcagcttcaacaagtgatca 118  Q
    ||||||||| ||||||||||||| ||||||||| ||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||    
29552318 attacaggataggtgctatagatatggaaaataaaatactgaaccagaaggatgtggcaggcaacactattttgcacatttcagcttcaacaagtgatca 29552417  T
119 acatgaggtaatcattcttctgagtattttagtagctaacatgaatgatctctaacaattgtattgttcattgattattaatcggtatgacaggcagttc 218  Q
    ||||||||||||||||||||| |||||||||| |||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||    
29552418 acatgaggtaatcattcttcttagtattttagcagctaacatgaatgatctctaacaattgcattgttcattgattattaatcggtatgacaggcagttc 29552517  T
219 gattgttggtaa 230  Q
    ||||||||||||    
29552518 gattgttggtaa 29552529  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7 (Bit Score: 31; Significance: 0.00000002; HSPs: 1)
Name: chr7
Description:

Target: chr7; HSP #1
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 143 - 189
Target Start/End: Complemental strand, 17293066 - 17293020
Alignment:
143 tattttagtagctaacatgaatgatctctaacaattgtattgttcat 189  Q
    ||||||||| ||||| ||||||||||| |||||||||||| ||||||    
17293066 tattttagttgctaatatgaatgatctttaacaattgtatcgttcat 17293020  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University