View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF19910_low_12 (Length: 245)
Name: NF19910_low_12
Description: NF19910
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF19910_low_12 |
 | |
|
Alignment Details
Target: chr8 (Bit Score: 184; Significance: 1e-99; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 184; E-Value: 1e-99
Query Start/End: Original strand, 19 - 230
Target Start/End: Original strand, 29552318 - 29552529
Alignment:
| Q |
19 |
attacaggacaggtgctatagatctggaaaatagaatactgaaccagaaggatttggcaggcaacactattttgcacatttcagcttcaacaagtgatca |
118 |
Q |
| |
|
||||||||| ||||||||||||| ||||||||| ||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
29552318 |
attacaggataggtgctatagatatggaaaataaaatactgaaccagaaggatgtggcaggcaacactattttgcacatttcagcttcaacaagtgatca |
29552417 |
T |
|
| Q |
119 |
acatgaggtaatcattcttctgagtattttagtagctaacatgaatgatctctaacaattgtattgttcattgattattaatcggtatgacaggcagttc |
218 |
Q |
| |
|
||||||||||||||||||||| |||||||||| |||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||| |
|
|
| T |
29552418 |
acatgaggtaatcattcttcttagtattttagcagctaacatgaatgatctctaacaattgcattgttcattgattattaatcggtatgacaggcagttc |
29552517 |
T |
|
| Q |
219 |
gattgttggtaa |
230 |
Q |
| |
|
|||||||||||| |
|
|
| T |
29552518 |
gattgttggtaa |
29552529 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7 (Bit Score: 31; Significance: 0.00000002; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 143 - 189
Target Start/End: Complemental strand, 17293066 - 17293020
Alignment:
| Q |
143 |
tattttagtagctaacatgaatgatctctaacaattgtattgttcat |
189 |
Q |
| |
|
||||||||| ||||| ||||||||||| |||||||||||| |||||| |
|
|
| T |
17293066 |
tattttagttgctaatatgaatgatctttaacaattgtatcgttcat |
17293020 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University