View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF19910_low_13 (Length: 232)
Name: NF19910_low_13
Description: NF19910
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF19910_low_13 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 89; Significance: 5e-43; HSPs: 2)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 89; E-Value: 5e-43
Query Start/End: Original strand, 20 - 136
Target Start/End: Original strand, 31639287 - 31639403
Alignment:
| Q |
20 |
ccaagcacatcatatattcaacttataacaatnnnnnnnntattaccggcattgcattctttacattgtggtccgatgtgccaaattgaaccggttcaac |
119 |
Q |
| |
|
|||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||| |
|
|
| T |
31639287 |
ccaagcacatcatatattcaacttataacaataaaaaaaatattaccggcattgcattctttacattgtggtccgatgtgccaaattgaaacggttcaac |
31639386 |
T |
 |
| Q |
120 |
gtggttggttcaatcag |
136 |
Q |
| |
|
||||||||||||||||| |
|
|
| T |
31639387 |
gtggttggttcaatcag |
31639403 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 48; E-Value: 1e-18
Query Start/End: Original strand, 170 - 217
Target Start/End: Original strand, 31639437 - 31639484
Alignment:
| Q |
170 |
gtcatctgactctgccgagagatgaaggtcttaccggttcaatctctg |
217 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
31639437 |
gtcatctgactctgccgagagatgaaggtcttaccggttcaatctctg |
31639484 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University