View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF19910_low_17 (Length: 212)
Name: NF19910_low_17
Description: NF19910
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF19910_low_17 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 127; Significance: 9e-66; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 127; E-Value: 9e-66
Query Start/End: Original strand, 38 - 196
Target Start/End: Original strand, 26629966 - 26630124
Alignment:
| Q |
38 |
atgaaacaaacagaagagagaaagcaaaactttgttttaaacattcctggtttagagataccttcagtagcaaattcaccaacaaattcacaagtaattt |
137 |
Q |
| |
|
||||||||||||||||||||||||||| | |||||| |||||||||||||||||||||| ||||| ||||||||||||||||||| |||||||||||||| |
|
|
| T |
26629966 |
atgaaacaaacagaagagagaaagcaagaatttgttgtaaacattcctggtttagagattccttcggtagcaaattcaccaacaatttcacaagtaattt |
26630065 |
T |
 |
| Q |
138 |
tccagccatgtcccttccttcgatattcttcttatgaaatccgttcttatggatataat |
196 |
Q |
| |
|
||||||||||||||||||||||||||||||||||| |||||| |||||||||||||||| |
|
|
| T |
26630066 |
tccagccatgtcccttccttcgatattcttcttataaaatccattcttatggatataat |
26630124 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University