View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF19910_low_18 (Length: 212)
Name: NF19910_low_18
Description: NF19910
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF19910_low_18 |
 |  |
|
| [»] chr4 (2 HSPs) |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 114; Significance: 5e-58; HSPs: 2)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 114; E-Value: 5e-58
Query Start/End: Original strand, 91 - 212
Target Start/End: Complemental strand, 28370337 - 28370216
Alignment:
| Q |
91 |
cggcaagtgacgtgtgcggtggcgccgtcgctgccgaaggaggagcgctgaataattacttctacgctgtgaacatcgccgacgagctcgggagagaaag |
190 |
Q |
| |
|
||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||| |
|
|
| T |
28370337 |
cggcaagagacgtgtgcggtggcgccgtcgctgccgaaggaggagcgctgaataattacttctacgctgtgaacatcgccgacgagctcgtgagagaaag |
28370238 |
T |
 |
| Q |
191 |
aagaatgacgggaagcacattt |
212 |
Q |
| |
|
|||||||||||||||||||||| |
|
|
| T |
28370237 |
aagaatgacgggaagcacattt |
28370216 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 112; E-Value: 8e-57
Query Start/End: Original strand, 93 - 212
Target Start/End: Original strand, 44776177 - 44776296
Alignment:
| Q |
93 |
gcaagtgacgtgtgcggtggcgccgtcgctgccgaaggaggagcgctgaataattacttctacgctgtgaacatcgccgacgagctcgggagagaaagaa |
192 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||| ||||||||||| |
|
|
| T |
44776177 |
gcaagtgacgtgtgcggtggcgccgtcgctgccgaaggaggagcgctgaataattacttgtacgctgtgaacatcgccgacgagctcgtgagagaaagaa |
44776276 |
T |
 |
| Q |
193 |
gaatgacgggaagcacattt |
212 |
Q |
| |
|
|||||||||||||||||||| |
|
|
| T |
44776277 |
gaatgacgggaagcacattt |
44776296 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University