View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF19910_low_19 (Length: 207)
Name: NF19910_low_19
Description: NF19910
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF19910_low_19 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 187; Significance: 1e-101; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 187; E-Value: 1e-101
Query Start/End: Original strand, 1 - 191
Target Start/End: Complemental strand, 4141491 - 4141301
Alignment:
| Q |
1 |
ttatattgaactggttttctaccaacaaaggtagtatagtgtctctagagttaactagtgcagatgaataacaagctcattgcatttcaaagaaatacta |
100 |
Q |
| |
|
||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
4141491 |
ttatattgaactggttttctatcaacaaaggtagtatagtgtctctagagttaactagtgcagatgaataacaagctcattgcatttcaaagaaatacta |
4141392 |
T |
|
| Q |
101 |
cattttgaataacaatctcattcgcaacgatattcttgtcatcgacccagtgttataatctttttgtcaacgctaaaaaatctcacaatgt |
191 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
4141391 |
cattttgaataacaatctcattcgcaacgatattcttgtcatcgacccagtgttataatctttttgtcaacgctaaaaaatctcacaatgt |
4141301 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University