View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF19911_high_9 (Length: 292)
Name: NF19911_high_9
Description: NF19911
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF19911_high_9 |
 | |
|
Alignment Details
Target: chr6 (Bit Score: 124; Significance: 8e-64; HSPs: 2)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 124; E-Value: 8e-64
Query Start/End: Original strand, 1 - 128
Target Start/End: Complemental strand, 5630605 - 5630478
Alignment:
| Q |
1 |
tcaaccactagagtgtagacctggtaaggtcacaaacccttcaggtaagacaatacccttgattgatcttggaggacatgatcatgctcataccatatta |
100 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
5630605 |
tcaaccactagagtgtagacctggtaaggtcacaaacccttcaagtaagacaatacccttgattgatcttggaggacatgatcatgctcataccatatta |
5630506 |
T |
|
| Q |
101 |
caaattttgaaagcttctgaagaatatg |
128 |
Q |
| |
|
|||||||||||||||||||||||||||| |
|
|
| T |
5630505 |
caaattttgaaagcttctgaagaatatg |
5630478 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #2
Raw Score: 81; E-Value: 4e-38
Query Start/End: Original strand, 171 - 279
Target Start/End: Complemental strand, 5630436 - 5630328
Alignment:
| Q |
171 |
gttcacctttctgcagaatttgttcaccctggtgaaatcggtgcattagagttgatatgattgcacctttcaaccatttctttaattttatatagaattt |
270 |
Q |
| |
|
|||||||||||||||||||||||||| |||| |||||||||||||||| |||| ||||||||||||||||||| ||||||||||||||||||||||||| |
|
|
| T |
5630436 |
gttcacctttctgcagaatttgttcatcctgatgaaatcggtgcattaatgttggtatgattgcacctttcaacaatttctttaattttatatagaattt |
5630337 |
T |
|
| Q |
271 |
ctattcttc |
279 |
Q |
| |
|
||| ||||| |
|
|
| T |
5630336 |
ctactcttc |
5630328 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2 (Bit Score: 32; Significance: 0.000000006; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 32; E-Value: 0.000000006
Query Start/End: Original strand, 2 - 33
Target Start/End: Original strand, 16433156 - 16433187
Alignment:
| Q |
2 |
caaccactagagtgtagacctggtaaggtcac |
33 |
Q |
| |
|
|||||||||||||||||||||||||||||||| |
|
|
| T |
16433156 |
caaccactagagtgtagacctggtaaggtcac |
16433187 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University