View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF19911_low_10 (Length: 264)
Name: NF19911_low_10
Description: NF19911
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF19911_low_10 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 208; Significance: 1e-114; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 208; E-Value: 1e-114
Query Start/End: Original strand, 15 - 247
Target Start/End: Original strand, 32360961 - 32361193
Alignment:
| Q |
15 |
aataattgtgatggttgattttagttatagagatcattttttaattttgctaattttgatgaacaaattcagattgcatgtacttacaatttcatgaaat |
114 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| | |
|
|
| T |
32360961 |
aataattgtgatggttgattttagttatagagatcattttttaattttgctaattttgatgaacaaattcagattgcatgtacttacaatttcatgaact |
32361060 |
T |
 |
| Q |
115 |
aaattactgattcattagtgaaatatgtattttatcaaaaacaatgaatatttttagattaccatttgtcacaaataggtagatcagttacttagctnnn |
214 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
32361061 |
aaattactgattcattagtgaaatatgtattttatcaaaaacaatgaatatttttagattaccatttgtcacaaataggtagatcagttacttagctaaa |
32361160 |
T |
 |
| Q |
215 |
nnnnccattgaaggagtttcatgcaagagtttg |
247 |
Q |
| |
|
||||||||||||||||||||||||||||| |
|
|
| T |
32361161 |
aaaaccattgaaggagtttcatgcaagagtttg |
32361193 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University