View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF19913_high_104 (Length: 220)

Name: NF19913_high_104
Description: NF19913
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF19913_high_104
NF19913_high_104
[»] chr7 (1 HSPs)
chr7 (14-203)||(31778676-31778865)


Alignment Details
Target: chr7 (Bit Score: 186; Significance: 1e-101; HSPs: 1)
Name: chr7
Description:

Target: chr7; HSP #1
Raw Score: 186; E-Value: 1e-101
Query Start/End: Original strand, 14 - 203
Target Start/End: Complemental strand, 31778865 - 31778676
Alignment:
14 atcagatctaacatctggcttcgggtgacccatgtgggcaaacaacaacttaattcctgaacaactttctctttttcctcatcatttagcaacgtaggat 113  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
31778865 atcagatctaacatctggcttcgggtgacccatgtgggcaaacaacaacttaattcctgaacaactttctctttttcctcatcatttagcaacgtaggat 31778766  T
114 cttctatgcaagtttctcccatacaaaatgatagactcatagcaacatcctgatcaatacttttatcccctcccacatcagacggcttca 203  Q
    |||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
31778765 cttctatgcaagtttctcccatacaagatgatagactcatagcaacatcctgatcaatacttttatcccctcccacatcagacggcttca 31778676  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University