View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF19913_high_47 (Length: 330)
Name: NF19913_high_47
Description: NF19913
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF19913_high_47 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 126; Significance: 6e-65; HSPs: 2)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 126; E-Value: 6e-65
Query Start/End: Original strand, 13 - 138
Target Start/End: Complemental strand, 12675916 - 12675791
Alignment:
| Q |
13 |
atactataccttaaataatcaaaactatttgacatctcaatcaaccatgaaatacaataaaggatcatcggagacatgattgctctacacatataggcta |
112 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
12675916 |
atactataccttaaataatcaaaactatttgacatctcaatcaaccatgaaatacaataaaggatcatcggagacatgattgctctacacatataggcta |
12675817 |
T |
|
| Q |
113 |
tagcactaaacaatttttcattggac |
138 |
Q |
| |
|
|||||||||||||||||||||||||| |
|
|
| T |
12675816 |
tagcactaaacaatttttcattggac |
12675791 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 88; E-Value: 3e-42
Query Start/End: Original strand, 196 - 291
Target Start/End: Complemental strand, 12675733 - 12675638
Alignment:
| Q |
196 |
ggtgctacaatagcaccatgtgacacatggtacaaacaagttcctgacttcttatactctttggtcacatttataaaataaaatactattttgtag |
291 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||| |||||| ||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
12675733 |
ggtgctacaatagcaccatgtgacacatggtacaaacaaattcctggcttcttatactctttggtcacatttataaaataaaatactattttgtag |
12675638 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University