View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF19913_high_87 (Length: 239)
Name: NF19913_high_87
Description: NF19913
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF19913_high_87 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 178; Significance: 4e-96; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 178; E-Value: 4e-96
Query Start/End: Original strand, 18 - 207
Target Start/End: Complemental strand, 43224876 - 43224687
Alignment:
| Q |
18 |
tctttatcctattatacaactctttcttatatctcgtctctagtaataatgttttgctttgaaattgattaatatagtcaatattatctgaaaagaacag |
117 |
Q |
| |
|
|||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
43224876 |
tctttatcctgttatacaactctttcttatatctcgtctctagtaataatgttttgctttgaaattgattaatatagtcaatattatctgaaaagaacag |
43224777 |
T |
 |
| Q |
118 |
cggagaacaacatgaaatcatgattgcaagaactagccgagacaaaaacagcctgtacagaaattatccagctgccccctccccatagcc |
207 |
Q |
| |
|
||||||||||||||||||||||| |||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
43224776 |
cggagaacaacatgaaatcatgactgcaagaactagccgaaacaaaaacagcctgtacagaaattatccagctgccccctccccatagcc |
43224687 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University