View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF19913_high_99 (Length: 226)
Name: NF19913_high_99
Description: NF19913
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF19913_high_99 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 80; Significance: 1e-37; HSPs: 3)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 80; E-Value: 1e-37
Query Start/End: Original strand, 61 - 148
Target Start/End: Complemental strand, 6830212 - 6830125
Alignment:
| Q |
61 |
accattactcgttcattgtattgtgctcgcataatccaagattcgtttggcaacttcgtcaaaaggaatattgaaactgataatatca |
148 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||| ||||||||||| |
|
|
| T |
6830212 |
accattactcgttcattgtattgtgctcgcataatccaagattcgtttgggaacttcgtcaaaaggaatattgaaattgataatatca |
6830125 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 11 - 58
Target Start/End: Complemental strand, 6830304 - 6830257
Alignment:
| Q |
11 |
tccaagaatatggttgaacttgtagtgcaagacacatctcgtggtatc |
58 |
Q |
| |
|
||||| |||||||||||||||||||| |||||||||||||||| |||| |
|
|
| T |
6830304 |
tccaataatatggttgaacttgtagtccaagacacatctcgtgatatc |
6830257 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #3
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 112 - 148
Target Start/End: Complemental strand, 6830118 - 6830082
Alignment:
| Q |
112 |
aacttcgtcaaaaggaatattgaaactgataatatca |
148 |
Q |
| |
|
||||| ||||||||||||||||||| ||||||||||| |
|
|
| T |
6830118 |
aactttgtcaaaaggaatattgaaattgataatatca |
6830082 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University