View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF19913_low_101 (Length: 227)
Name: NF19913_low_101
Description: NF19913
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF19913_low_101 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 174; Significance: 9e-94; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 174; E-Value: 9e-94
Query Start/End: Original strand, 15 - 209
Target Start/End: Complemental strand, 2831251 - 2831057
Alignment:
| Q |
15 |
aatatgaatatgtctaaacattccaatggacaggaacacaataaaaattcccaagagttagagatgaaactctcacaatgtgaaacaagtgatgatgaag |
114 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
2831251 |
aatatgaatatgtctaaacattccaatggacaggaacacaataaaaattcccaagagttagagatgaaactctcacaatgtgaaacaagtgatgatgaag |
2831152 |
T |
 |
| Q |
115 |
atcaaaaagcattggatgatcttgtcaaggagaaaagtgatgccaaggagacacacttgcttgagnnnnnnnttatagacttgtatggtgaaatt |
209 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||| |
|
|
| T |
2831151 |
atcaaaaagcattggatgatcttgtcaaggagaaaagtgatgccaaggagacacacttgcttgagaaaaaaattatagacttgtatggtgaaatt |
2831057 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University