View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF19913_low_104 (Length: 226)
Name: NF19913_low_104
Description: NF19913
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF19913_low_104 |
 | |
|
| [»] chr3 (1 HSPs) |
| |
|
Alignment Details
Target: chr3 (Bit Score: 168; Significance: 3e-90; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 168; E-Value: 3e-90
Query Start/End: Original strand, 1 - 226
Target Start/End: Original strand, 53618864 - 53619099
Alignment:
| Q |
1 |
tttaaattagaatacggcaaaccaatatggtgtggcacaagtgagagatactctagtttacaaaaaagaaaacaacatcgtctgtttatttgttttgaga |
100 |
Q |
| |
|
|||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
53618864 |
tttaaattaggatacggcaaaccaatatggtgtggcacaagtgagagatactctagtttacaaaaaagaaaacaacatcgtctgtttatttgttttgaga |
53618963 |
T |
|
| Q |
101 |
aacgccatcatctattgatatcagtagagtttcatgcttannnnnnnct----------tattacatcaaattacatgagaatattatatttcttttatc |
190 |
Q |
| |
|
|||||||||||||||||||||| ||||||||||||||||| || ||| ||||||||||||||||||||||||||||||||||||| |
|
|
| T |
53618964 |
aacgccatcatctattgatatctgtagagtttcatgcttatttttttcttatcacagcatatcacatcaaattacatgagaatattatatttcttttatc |
53619063 |
T |
|
| Q |
191 |
catccaattctctttccttgcctcaattcttataat |
226 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||| |
|
|
| T |
53619064 |
catccaattctctttccttgcctcaattcttataat |
53619099 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University