View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF19913_low_110 (Length: 216)
Name: NF19913_low_110
Description: NF19913
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF19913_low_110 |
 | |
|
Alignment Details
Target: chr6 (Bit Score: 104; Significance: 5e-52; HSPs: 2)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 104; E-Value: 5e-52
Query Start/End: Original strand, 97 - 200
Target Start/End: Complemental strand, 34621714 - 34621611
Alignment:
| Q |
97 |
tcatggtttaggatttgggctagttcaatttttcgttggtttagttttgaaaattttaatttgaacccttcaattatttttcatacccctacaaacgcaa |
196 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
34621714 |
tcatggtttaggatttgggctagttcaatttttcgttggtttagttttgaaaattttaatttgaacccttcaattatttttcatacccctacaaacgcaa |
34621615 |
T |
|
| Q |
197 |
taaa |
200 |
Q |
| |
|
|||| |
|
|
| T |
34621614 |
taaa |
34621611 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #2
Raw Score: 104; E-Value: 5e-52
Query Start/End: Original strand, 97 - 200
Target Start/End: Complemental strand, 34749151 - 34749048
Alignment:
| Q |
97 |
tcatggtttaggatttgggctagttcaatttttcgttggtttagttttgaaaattttaatttgaacccttcaattatttttcatacccctacaaacgcaa |
196 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
34749151 |
tcatggtttaggatttgggctagttcaatttttcgttggtttagttttgaaaattttaatttgaacccttcaattatttttcatacccctacaaacgcaa |
34749052 |
T |
|
| Q |
197 |
taaa |
200 |
Q |
| |
|
|||| |
|
|
| T |
34749051 |
taaa |
34749048 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University