View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF19913_low_26 (Length: 433)
Name: NF19913_low_26
Description: NF19913
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF19913_low_26 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 286; Significance: 1e-160; HSPs: 2)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 286; E-Value: 1e-160
Query Start/End: Original strand, 9 - 318
Target Start/End: Original strand, 53674819 - 53675128
Alignment:
| Q |
9 |
gaagaatatcagcagaaattgacttggcttcctccactaaaccaccacctactgtggaactcaatgccacttttgcctccaaattaacctgataatgatg |
108 |
Q |
| |
|
|||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
53674819 |
gaagaaaatcagcagaaattgacttggcttcctccactaaaccaccacctactgtggaactcaatgccacttttgcctccaaattaacctgataatgatg |
53674918 |
T |
 |
| Q |
109 |
ttttcatcagcattcttcgactctaatagcaaaccatattaaagtctaaccattatatgacagacagggtcaactatatttttgattccctctaaaatac |
208 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||| |
|
|
| T |
53674919 |
ttttcatcagcattcttcgactctaatagcaaaccatattaaagtctaaccattatatgacagacagggtcaactatattttttattccctctaaaatac |
53675018 |
T |
 |
| Q |
209 |
tcttcatcttagtacttactaaaatttggtcccctccatgtctctagaatccatccctattcaatgtcgttttttgcggactaatcagaaggaatgcaaa |
308 |
Q |
| |
|
|||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||| ||||||||||||||| |||||||||||||||||||||| |
|
|
| T |
53675019 |
tcttcatcttagtacttactaaaatttggtccactccatgtctctagaatccatccctatcgaatgtcgttttttgcagactaatcagaaggaatgcaaa |
53675118 |
T |
 |
| Q |
309 |
tcacgtaaac |
318 |
Q |
| |
|
|||||||||| |
|
|
| T |
53675119 |
tcacgtaaac |
53675128 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 95; E-Value: 2e-46
Query Start/End: Original strand, 319 - 417
Target Start/End: Original strand, 53675181 - 53675279
Alignment:
| Q |
319 |
atgtgttgcattccccctatccaataacaaaacattattttttcctcaattttattgatgatggagacacatatatacttgtatgatttgattcacgtg |
417 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
53675181 |
atgtgttgcattccccctatccaataacaaaacattattttttccccaattttattgatgatggagacacatatatacttgtatgatttgattcacgtg |
53675279 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University