View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF19913_low_33 (Length: 417)
Name: NF19913_low_33
Description: NF19913
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF19913_low_33 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 383; Significance: 0; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 383; E-Value: 0
Query Start/End: Original strand, 9 - 403
Target Start/End: Complemental strand, 16730075 - 16729681
Alignment:
| Q |
9 |
gagatgaagaggcgacaacctccccatgaagcctggtgaagcaagaccattcatgggttgataatgaagcttgtggaaacccttatgttctgaacgtttc |
108 |
Q |
| |
|
|||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
16730075 |
gagacgaagaggcgacaacctccccatgaagcctggtgaagcaagaccattcatgggttgataatgaagcttgtggaaacccttatgttctgaacgtttc |
16729976 |
T |
 |
| Q |
109 |
atttctccattgaaggtcccacatttcaccatccaccatctctttttggttgggatatgatggcttgagttcattttgttgcacatgtactcttttacca |
208 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
16729975 |
atttctccattgaaggtcccacatttcaccatccaccatctctttttggttgggatatgatggcttgagttcattttgttgcacatgtactcttttacca |
16729876 |
T |
 |
| Q |
209 |
catgcaatccctgctccaccacctcctgtggaggcgaaatgagtgggtttccctccacacttagcttttggagcttctggaggcatccgatggagtcggg |
308 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
16729875 |
catgcaatccctgctccaccacctcctgtggaggcgaaatgagtgggtttccctccacacttagcttttggagcttctggaggcatccgatggagtcggg |
16729776 |
T |
 |
| Q |
309 |
caatgttttgatattgttatagctaacatctagttcaactagggacaagaggagtcctatggagtagggcaatgactccaagtaccggaaattct |
403 |
Q |
| |
|
|||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||| |
|
|
| T |
16729775 |
caatgttttgatattgttgtagctaacatctagttcaactagggacaagaggagtcctatggagtagggcaatgactccaagtaccgaaaattct |
16729681 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University