View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF19913_low_39 (Length: 385)
Name: NF19913_low_39
Description: NF19913
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF19913_low_39 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 345; Significance: 0; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 345; E-Value: 0
Query Start/End: Original strand, 15 - 375
Target Start/End: Original strand, 8458964 - 8459324
Alignment:
| Q |
15 |
tatcggaatccagcgcgacaattggaataatctgttactgtcatcaattaacatgatgacactttccgcttcatcaatggttggtcttgcagccgttgct |
114 |
Q |
| |
|
||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||| |||||||||||||||||||||||||| |||||| |
|
|
| T |
8458964 |
tatcggaatccagcgcgacaattggaataatcttttactgtcatcaattaacatgatgacactttctgcttcatcaatggttggtcttgcagcggttgct |
8459063 |
T |
 |
| Q |
115 |
tcgaccggaggtgaagcatcacttgtagcattgaaagtttcttccacaattctttacatggctgcaactggtttacttctgttcatgaacaaagttcagc |
214 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
8459064 |
tcgaccggaggtgaagcatcacttgtagcattgaaagtttcttccacaattctttacatggctgcaactggtttacttctgttcatgaacaaagttcagc |
8459163 |
T |
 |
| Q |
215 |
cgtcgcagcttgcagaagaacaaagaaatgctactagattttttaagcagcttcaaggagaggtaagaacaaagcttgctcttgggaattttagtgaagc |
314 |
Q |
| |
|
| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
8459164 |
catcgcagcttgcagaagaacaaagaaatgctactagattttttaagcagcttcaaggagaggtaagaacaaagcttgctcttgggaattttagtgaagc |
8459263 |
T |
 |
| Q |
315 |
tgatgtcaatgaagcaatgaagaaagttttggcattggataaagcttaccctcttcctttg |
375 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
8459264 |
tgatgtcaatgaagcaatgaagaaagttttggcattggataaagcttaccctcttcctttg |
8459324 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3 (Bit Score: 55; Significance: 2e-22; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 55; E-Value: 2e-22
Query Start/End: Original strand, 148 - 246
Target Start/End: Complemental strand, 1617908 - 1617810
Alignment:
| Q |
148 |
aaagtttcttccacaattctttacatggctgcaactggtttacttctgttcatgaacaaagttcagccgtcgcagcttgcagaagaacaaagaaatgct |
246 |
Q |
| |
|
||||||||||||||||||||||| ||| ||||||||| |||||||||||||||||||||| | ||||| || ||||||| ||| ||||| |||||||| |
|
|
| T |
1617908 |
aaagtttcttccacaattctttatatgtctgcaactgctttacttctgttcatgaacaaaatccagccatcccagcttgtagaggaacagggaaatgct |
1617810 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7 (Bit Score: 31; Significance: 0.00000003; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 180 - 246
Target Start/End: Complemental strand, 18790886 - 18790820
Alignment:
| Q |
180 |
aactggtttacttctgttcatgaacaaagttcagccgtcgcagcttgcagaagaacaaagaaatgct |
246 |
Q |
| |
|
||||||||||||||||||||| |||||| | ||||| || ||||||| ||| ||||| |||||||| |
|
|
| T |
18790886 |
aactggtttacttctgttcataaacaaaatccagccatcacagcttgtagaggaacagggaaatgct |
18790820 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University