View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF19913_low_63 (Length: 281)
Name: NF19913_low_63
Description: NF19913
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF19913_low_63 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 208; Significance: 1e-114; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 208; E-Value: 1e-114
Query Start/End: Original strand, 16 - 274
Target Start/End: Complemental strand, 38466525 - 38466257
Alignment:
| Q |
16 |
aggaattcattgagggatttgagaccctcttctgtgtgaagatctgagaaggtaacagccattagggtttgcgatgaatcggtggcggagagtgaagacg |
115 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
38466525 |
aggaattcattgagggatttgagaccctcttctgtgtgaagatctgagaaggtaacagccattagggtttgcgatgaatcggtggcggagagtgaagacg |
38466426 |
T |
|
| Q |
116 |
aaaatagagtgtgtcgagtgttgagtgttg-------agagagagttttgggcttcaataattggtatttatatgatgcataatctcaaaccctaaatca |
208 |
Q |
| |
|
|||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
38466425 |
aaaatagagtgtgtcgagtgttgagtgttgagagttgagagagagttttgggcttcaataattggtatttatatgatgcataatctcaaaccctaaatca |
38466326 |
T |
|
| Q |
209 |
tacacaccccactcttcaatat---tattannnnnnnctcaaaaatattattagtattagtatattctt |
274 |
Q |
| |
|
|||||||||||||||||||||| ||||| |||||||||||||||||||||||||||||||| |
|
|
| T |
38466325 |
tacacaccccactcttcaatattagtattatttttttctcaaaaatattattagtattagtatattctt |
38466257 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University