View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF19913_low_66 (Length: 267)
Name: NF19913_low_66
Description: NF19913
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF19913_low_66 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 236; Significance: 1e-130; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 236; E-Value: 1e-130
Query Start/End: Original strand, 15 - 250
Target Start/End: Original strand, 39751022 - 39751257
Alignment:
| Q |
15 |
aatattaactaactaattgatttcatgtttcaatttagagcataggatatgcaacattggcaaaccttgctcctcaatatggactttgtaagctactttt |
114 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
39751022 |
aatattaactaactaattgatttcatgtttcaatttagagcataggatatgcaacattggcaaaccttgctcctcaatatggactttgtaagctactttt |
39751121 |
T |
|
| Q |
115 |
ttaaaatatatgtttttcttccccttatcttcttctaaggaaattatattataattgatttactttatatacaacttttgcgcaaaaataaaattacatt |
214 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
39751122 |
ttaaaatatatgtttttcttccccttatcttcttctaaggaaattatattataattgatttactttatatacaacttttgcgcaaaaataaaattacatt |
39751221 |
T |
|
| Q |
215 |
atcaattaattataactatatgatcataatcaattt |
250 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||| |
|
|
| T |
39751222 |
atcaattaattataactatatgatcataatcaattt |
39751257 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University