View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF19913_low_68 (Length: 265)
Name: NF19913_low_68
Description: NF19913
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF19913_low_68 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 187; Significance: 1e-101; HSPs: 2)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 187; E-Value: 1e-101
Query Start/End: Original strand, 1 - 215
Target Start/End: Original strand, 12675894 - 12676107
Alignment:
| Q |
1 |
tttgattatttaaggtatagtattatttgaggtgaacacttaggtacatacgaaatttaatttggtggatgagtaccaaactttgttgggtgaattggaa |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||| ||| |
|
|
| T |
12675894 |
tttgattatttaaggtatagtattatttgaggtgaacacttaggtacataagaaatttaatttggtggatgagtaccaaactttgttgggtgaattagaa |
12675993 |
T |
|
| Q |
101 |
accctaactaatatggaattaagtgcttccatgtgagttgaaggatctaactttctgatattttttcaacaaagtagcaaaaaagggagaaagacagaca |
200 |
Q |
| |
|
|||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||| ||| |
|
|
| T |
12675994 |
accctaactaatttggaattaagtgcttccatgtgagttgaaggatctaactttctgatattttttcaacaaagtagcaaaaaa-ggagaaagacaaaca |
12676092 |
T |
|
| Q |
201 |
agaaaaggtagagta |
215 |
Q |
| |
|
||||| ||||||||| |
|
|
| T |
12676093 |
agaaacggtagagta |
12676107 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 41; E-Value: 0.00000000000002
Query Start/End: Original strand, 215 - 259
Target Start/End: Original strand, 12676145 - 12676189
Alignment:
| Q |
215 |
aatatgataagatcaaggtgcaccacaagagtaagatattcttgg |
259 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||| |||| |
|
|
| T |
12676145 |
aatatgataagatcaaggtgcaccacaagagtaagatattattgg |
12676189 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University