View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF19913_low_79 (Length: 250)
Name: NF19913_low_79
Description: NF19913
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF19913_low_79 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 227; Significance: 1e-125; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 227; E-Value: 1e-125
Query Start/End: Original strand, 13 - 247
Target Start/End: Complemental strand, 28227056 - 28226822
Alignment:
| Q |
13 |
aatatcttggcaaaactcttgcccgaacatgattgagcaaaacattgcggctaaacatatttgaaatctgaccgttcatttcttcgaatttctccagttc |
112 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
28227056 |
aatatcttggcaaaactcttgcccgaacatgattgagcaaaacattgcggctaaacatatttgaaatctgaccgttcatttcttcgaatttctccagttc |
28226957 |
T |
 |
| Q |
113 |
tactgccttatatttcaacacctccaggtttagtttcatgtgttttttctcttgggacaagccgtctatgctggcttcattatacaaaactatttgggaa |
212 |
Q |
| |
|
|||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
28226956 |
tactgccttatatttcaacacctccaagtttagtttcatgtgttttttctcttgggacaagccgtctatgctggcttcattatacaaaactatttgggaa |
28226857 |
T |
 |
| Q |
213 |
cggcttattcttggactctctgttacaaagttgct |
247 |
Q |
| |
|
|||||| |||||||||||||||||||||||||||| |
|
|
| T |
28226856 |
cggctttttcttggactctctgttacaaagttgct |
28226822 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University