View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF19913_low_86 (Length: 242)
Name: NF19913_low_86
Description: NF19913
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF19913_low_86 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 198; Significance: 1e-108; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 198; E-Value: 1e-108
Query Start/End: Original strand, 1 - 223
Target Start/End: Complemental strand, 4187788 - 4187570
Alignment:
| Q |
1 |
ctctacaaacatgcatgtagtaatgatgttgatgccatattcttatgtcaaagagataggtcagggtcgtaaattgttccataatgggaagtgcctaact |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||| |
|
|
| T |
4187788 |
ctctacaaacatgcatgtagtaatgatgttgatgccatattcttatgtcaaagagataggtcagggtcgtcaattgttccataatgggaagtgcctaact |
4187689 |
T |
|
| Q |
101 |
agctaatatatactcaaattctacggtaaagaaaacgtgtttatttggattgcattattatgtatcgtacattgcattaatcttctatcacatgggttgg |
200 |
Q |
| |
|
|||||||| |||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
4187688 |
agctaata----ctcaaattctacggtaaagaaaacgtgtttatttggattgcactattatgtatcgtacattgcattaatcttctatcacatgggttgg |
4187593 |
T |
|
| Q |
201 |
tttagctgtttaggggtaatgag |
223 |
Q |
| |
|
||||||||||||||||||||||| |
|
|
| T |
4187592 |
tttagctgtttaggggtaatgag |
4187570 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University