View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF19913_low_90 (Length: 240)
Name: NF19913_low_90
Description: NF19913
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF19913_low_90 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 85; Significance: 1e-40; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 85; E-Value: 1e-40
Query Start/End: Original strand, 14 - 139
Target Start/End: Complemental strand, 52947683 - 52947557
Alignment:
| Q |
14 |
cgtctctgttcttacaccatgactctttagcttctctgaaaccctatttcacaaggacgaaatgcaaaaatgaaaaca--ttttttcaataaataggggg |
111 |
Q |
| |
|
|||||||||||||||||||||||||| || |||||||||||||||||||||||||||||||||| ||||||| | || |||||||||||||||||||| |
|
|
| T |
52947683 |
cgtctctgttcttacaccatgactctctaacttctctgaaaccctatttcacaaggacgaaatg-gaaaatgagagcattttttttcaataaataggggg |
52947585 |
T |
|
| Q |
112 |
gaaatcaaaagacatgatgactcaccaa |
139 |
Q |
| |
|
|||||||||||||| ||||||||||||| |
|
|
| T |
52947584 |
gaaatcaaaagacaggatgactcaccaa |
52947557 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University