View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF19913_low_96 (Length: 236)

Name: NF19913_low_96
Description: NF19913
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF19913_low_96
NF19913_low_96
[»] chr4 (1 HSPs)
chr4 (1-221)||(28226310-28226530)


Alignment Details
Target: chr4 (Bit Score: 213; Significance: 1e-117; HSPs: 1)
Name: chr4
Description:

Target: chr4; HSP #1
Raw Score: 213; E-Value: 1e-117
Query Start/End: Original strand, 1 - 221
Target Start/End: Complemental strand, 28226530 - 28226310
Alignment:
1 aatatttaatatcaatgacacttatgaactgcaaatttttattcacagtgatcgcctcagaccaaaatatatgacacaaatatgagtgtggctgtggaga 100  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||| |    
28226530 aatatttaatatcaatgacacttatgaactgcaaatttttattcacagtgatggcctcagaccaaaatatatgacacaaatatgagtgtggctgtggaaa 28226431  T
101 acttgaaaaagaatatacgtcattataagaaaatgcagatttcagaaaggcaagagttcactaggaatgggaaaagaagttatttatgcatctgctcttt 200  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
28226430 acttgaaaaagaatatacgtcattataagaaaatgcagatttcagaaaggcaagagttcactaggaatgggaaaagaagttatttatgcatctgctcttt 28226331  T
201 tcgatttcttatgattcttta 221  Q
    |||||||||||||||||||||    
28226330 tcgatttcttatgattcttta 28226310  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University