View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF19913_low_98 (Length: 235)
Name: NF19913_low_98
Description: NF19913
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF19913_low_98 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 170; Significance: 2e-91; HSPs: 2)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 170; E-Value: 2e-91
Query Start/End: Original strand, 43 - 220
Target Start/End: Complemental strand, 43901571 - 43901394
Alignment:
| Q |
43 |
cttatgccaaagtatcagggtatataacttaactattcctctgaatctataatatgtcttagcctgcaaatttagaattaatatgtgcaaactaatcact |
142 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
43901571 |
cttatgccaaagtatcagggtatataacttaactattactctgaatctataatatgtcttagcctgcaaatttagaattaatatgtgcaaactaatcact |
43901472 |
T |
 |
| Q |
143 |
tgttagaaaattagttcctgcaatccctatcaatccatatcagtcaaattaaattaacataattgatcgtattttttg |
220 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||| |
|
|
| T |
43901471 |
tgttagaaaattagttcctgcaatccctatcaatccatatcagtcaaattaaattaacagaattgatcgtattttttg |
43901394 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 46; E-Value: 2e-17
Query Start/End: Original strand, 1 - 46
Target Start/End: Original strand, 43901549 - 43901594
Alignment:
| Q |
1 |
ataccctgatactttggcataaggccactgtccattagaggactta |
46 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
43901549 |
ataccctgatactttggcataaggccactgtccattagaggactta |
43901594 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University