View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF19914_high_15 (Length: 244)
Name: NF19914_high_15
Description: NF19914
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF19914_high_15 |
 | |
|
Alignment Details
Target: chr8 (Bit Score: 169; Significance: 9e-91; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 169; E-Value: 9e-91
Query Start/End: Original strand, 19 - 232
Target Start/End: Complemental strand, 45304175 - 45303971
Alignment:
| Q |
19 |
atgaaaagggtcctaaaagctgcattacttcctttctgtcggggctgctgttatgaaacttagctgggcttttggggcttgtgcatattcattcaagtca |
118 |
Q |
| |
|
|||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
45304175 |
atgaaaagggtcctaaaagctgcattccttcctttctgtcggggctgctgttatgaaacttagctgggcttttggggcttgtgcatattcattcaagtca |
45304076 |
T |
|
| Q |
119 |
agtcagtagcttttgggcactcccccattccattattcttctttctatgaaatgaaatgaaattgagagaccaccaaaacaaacaagacaaccctcacct |
218 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||| | ||||||||||||||||| |||||||||||||| |
|
|
| T |
45304075 |
agtcagtagcttttgggcactcccccattccattattcttctttctatgaaatgaaat-----ttagagaccaccaaaacaa----gacaaccctcacct |
45303985 |
T |
|
| Q |
219 |
tcacacctttgctt |
232 |
Q |
| |
|
|||||||||||||| |
|
|
| T |
45303984 |
tcacacctttgctt |
45303971 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University