View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF19914_low_11 (Length: 260)
Name: NF19914_low_11
Description: NF19914
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF19914_low_11 |
 |  |
|
| [»] chr4 (1 HSPs) |
 |  |
|
| [»] chr2 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 252; Significance: 1e-140; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 252; E-Value: 1e-140
Query Start/End: Original strand, 1 - 260
Target Start/End: Complemental strand, 35722026 - 35721767
Alignment:
| Q |
1 |
gaattagagcttgatatagagatgaaggaatgcttttgtgatcaccaacttgaagaggagtttgaattgccatgtggctattcatatttgtaatagaggt |
100 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||| |
|
|
| T |
35722026 |
gaattagagcttgatatagagatgaaggaatgcttttgtgatcaccaacttgaagaggagtttgaattgccatgttgctattcatatttgtaatagaggt |
35721927 |
T |
 |
| Q |
101 |
ggtgcaagtagtactagtagtagttatggtggtggaagaagtaactggtgtggttggtttcttgatcctcttattctttctgccaccaccaacaggaaca |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
35721926 |
ggtgcaagtagtactagtagtagttatggtggtggaagaagtaactggtgtggttggtttcttgatcctcttattctttctgccaccaccaacaggaaca |
35721827 |
T |
 |
| Q |
201 |
ttgcgtagagttccacctttagtccagtgtcttttacaagctctacagaaatgacgaggt |
260 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||| |
|
|
| T |
35721826 |
ttgcgtagagttccacctttagtccagtgtcttttacaagctctacagaagtgacgaggt |
35721767 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2 (Bit Score: 49; Significance: 4e-19; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 49; E-Value: 4e-19
Query Start/End: Original strand, 168 - 260
Target Start/End: Complemental strand, 3591994 - 3591902
Alignment:
| Q |
168 |
ctcttattctttctgccaccaccaacaggaacattgcgtagagttccacctttagtccagtgtcttttacaagctctacagaaatgacgaggt |
260 |
Q |
| |
|
||||||||||| || ||||||||||||||||||| | |||||| |||||||||||||| ||||| |||||||| || |||||||| |||||| |
|
|
| T |
3591994 |
ctcttattcttcctaacaccaccaacaggaacattccttagagtaccacctttagtccaatgtctcttacaagccctgcagaaatggcgaggt |
3591902 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University