View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF19914_low_17 (Length: 243)
Name: NF19914_low_17
Description: NF19914
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF19914_low_17 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 178; Significance: 4e-96; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 178; E-Value: 4e-96
Query Start/End: Original strand, 1 - 226
Target Start/End: Complemental strand, 35721623 - 35721392
Alignment:
| Q |
1 |
ttgagattctaataaggtttgtttccaatcaagtccactgctagaaataacctgtttagaactcaaacccatgtcttaaattcaactctttaaaagtact |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
35721623 |
ttgagattctaataaggtttgtttccaatcaagtccactgctagaaataacctgtttagaactcaaacccatgtcttaaattcaactctttaaaagtact |
35721524 |
T |
|
| Q |
101 |
aatcaacc--nnnnnnncaaatcatgaa---aagaagaagaaaagtttatcccttagctttgattgaggatgtgattgttggttttggagt-ggttttga |
194 |
Q |
| |
|
|||||||| ||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||| |
|
|
| T |
35721523 |
aatcaaccaaaaaaaaacaaatcatgaaaagaagaagaagaaaagtttatcccttagctttgattgaggatgtgattgttggttttggagtgggttttga |
35721424 |
T |
|
| Q |
195 |
aggtgagaacaagtgagtttatgatctatttg |
226 |
Q |
| |
|
|||||||||||||||||||||||||||||||| |
|
|
| T |
35721423 |
aggtgagaacaagtgagtttatgatctatttg |
35721392 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University