View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF19914_low_18 (Length: 220)

Name: NF19914_low_18
Description: NF19914
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF19914_low_18
NF19914_low_18
[»] chr2 (1 HSPs)
chr2 (44-204)||(37827411-37827572)


Alignment Details
Target: chr2 (Bit Score: 154; Significance: 7e-82; HSPs: 1)
Name: chr2
Description:

Target: chr2; HSP #1
Raw Score: 154; E-Value: 7e-82
Query Start/End: Original strand, 44 - 204
Target Start/End: Original strand, 37827411 - 37827572
Alignment:
44 ttgcttgatataaa-tcccatttgttggtaagaattgctcttatggagttttggaggcatatcattgcagccactcctagctagataacaatgaattgac 142  Q
    |||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
37827411 ttgcttgatataaaatcccatttgttggtaagaattgctcttatggagttttggaggcatatcattgcagccactcctagctagataacaatgaattgac 37827510  T
143 aagggccaactcttttatatctttatcaatattcatgtgactttgggcagatctggggggtt 204  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
37827511 aagggccaactcttttatatctttatcaatattcatgtgactttgggcagatctggggggtt 37827572  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University