View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF19914_low_18 (Length: 220)
Name: NF19914_low_18
Description: NF19914
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF19914_low_18 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 154; Significance: 7e-82; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 154; E-Value: 7e-82
Query Start/End: Original strand, 44 - 204
Target Start/End: Original strand, 37827411 - 37827572
Alignment:
| Q |
44 |
ttgcttgatataaa-tcccatttgttggtaagaattgctcttatggagttttggaggcatatcattgcagccactcctagctagataacaatgaattgac |
142 |
Q |
| |
|
|||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
37827411 |
ttgcttgatataaaatcccatttgttggtaagaattgctcttatggagttttggaggcatatcattgcagccactcctagctagataacaatgaattgac |
37827510 |
T |
 |
| Q |
143 |
aagggccaactcttttatatctttatcaatattcatgtgactttgggcagatctggggggtt |
204 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
37827511 |
aagggccaactcttttatatctttatcaatattcatgtgactttgggcagatctggggggtt |
37827572 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University