View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF19915_high_15 (Length: 414)
Name: NF19915_high_15
Description: NF19915
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF19915_high_15 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 94; Significance: 9e-46; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 94; E-Value: 9e-46
Query Start/End: Original strand, 37 - 147
Target Start/End: Original strand, 12869600 - 12869714
Alignment:
| Q |
37 |
atgtgttgtttgtatggttgtaattagatctcttcatctagccttatattttcactttattttctaatttaatatagtcatgcaagtgtt----ttctag |
132 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||| |
|
|
| T |
12869600 |
atgtgttgtttgtatggttgtaattagatctcttcatctagccttatattttcactttattttctaatttaatatagtcatgcaagtgttttaattctag |
12869699 |
T |
|
| Q |
133 |
gcttaaccatccatt |
147 |
Q |
| |
|
||| ||||||||||| |
|
|
| T |
12869700 |
gctcaaccatccatt |
12869714 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University