View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF19915_high_27 (Length: 345)
Name: NF19915_high_27
Description: NF19915
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF19915_high_27 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 140; Significance: 3e-73; HSPs: 2)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 140; E-Value: 3e-73
Query Start/End: Original strand, 14 - 216
Target Start/End: Original strand, 42896786 - 42896997
Alignment:
| Q |
14 |
cataggcatcacaatgtaacaaagggaactacaatgtcgaaaatacat----------attatcttgatgtggaagtatctgatttagtgtgatttttgt |
103 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||| | |||||||||| |||| ||||||||||||||||||||||| |
|
|
| T |
42896786 |
cataggcatcacaatgtaacaaagggaactacaatgtcgaaaatacattctctgatgtaatatcttgatg--gaagaatctgatttagtgtgatttttgt |
42896883 |
T |
 |
| Q |
104 |
tttatttatattttatctaaaattacttgtgggg-aaaaacacacaatcaaaatttgatattgaagtagtaaaagttgagaaaaatatcataattttgtc |
202 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||| ||||||| ||||||||||||||||||||||||| |
|
|
| T |
42896884 |
tttatttatattttatctaaaattacttgtgggggaaaaacacacaatcaaaatttgatattgaaggagtaaaatttgagaaaaatatcataattttgtc |
42896983 |
T |
 |
| Q |
203 |
ttaaatatttacaa |
216 |
Q |
| |
|
||| |||||||||| |
|
|
| T |
42896984 |
ttatatatttacaa |
42896997 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 93; E-Value: 3e-45
Query Start/End: Original strand, 212 - 325
Target Start/End: Original strand, 42897098 - 42897211
Alignment:
| Q |
212 |
tacaatcaatcacgttagagataaagtaagaaggaaatacaagacaaatagaannnnnnnattgaatccatggcttgctaattgtacacttaacaaccaa |
311 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
42897098 |
tacaatcaatcacgttagagataaagtaagaaggaaatacaagacaaatagaaattttttattgaatccatggcttgctaattgtacacttaacaaccaa |
42897197 |
T |
 |
| Q |
312 |
taaaaatggtccaa |
325 |
Q |
| |
|
|||||||||||||| |
|
|
| T |
42897198 |
taaaaatggtccaa |
42897211 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University