View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF19915_high_51 (Length: 259)
Name: NF19915_high_51
Description: NF19915
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF19915_high_51 |
 | |
|
Alignment Details
Target: chr6 (Bit Score: 169; Significance: 1e-90; HSPs: 2)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 169; E-Value: 1e-90
Query Start/End: Original strand, 12 - 240
Target Start/End: Complemental strand, 5636677 - 5636462
Alignment:
| Q |
12 |
tatactagtacacccaatgcatgtttggatcaacggtgagtttgaaaaaatcatgatggcaccgtgattttgtttaaacaccaaagtgcacatttttcca |
111 |
Q |
| |
|
|||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||| ||||||||||||||||||||||||||| |
|
|
| T |
5636677 |
tatactagtacaaccaatgcatgtttggatcaacggtgagtttgaaaaaatcatgatggcacagtgattttgcttaaacaccaaagtgcacatttttcca |
5636578 |
T |
|
| Q |
112 |
aaaatcagtgtcatatctcgactgtcaaactcgttgtcaattcaaacatgccctaaataaacttttaaacatgggaaactaagtaaataataatgtttcc |
211 |
Q |
| |
|
|||||||| ||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
5636577 |
aaaatcagagtcatat-------------ctcgttgtcaattcaaacatgccctaaataaacttttaaacatgggaaactaagtaaataataatgtttcc |
5636491 |
T |
|
| Q |
212 |
tacttgctttgattttgtgaaaaatgtaa |
240 |
Q |
| |
|
||||||||||||||||||||||||||||| |
|
|
| T |
5636490 |
tacttgctttgattttgtgaaaaatgtaa |
5636462 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #2
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 49 - 85
Target Start/End: Original strand, 3165489 - 3165525
Alignment:
| Q |
49 |
gagtttgaaaaaatcatgatggcaccgtgattttgtt |
85 |
Q |
| |
|
|||||||| |||||||||||| ||||||||||||||| |
|
|
| T |
3165489 |
gagtttgacaaaatcatgatgacaccgtgattttgtt |
3165525 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2 (Bit Score: 29; Significance: 0.0000003; HSPs: 2)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 29 - 101
Target Start/End: Original strand, 10734535 - 10734607
Alignment:
| Q |
29 |
tgcatgtttggatcaacggtgagtttgaaaaaatcatgatggcaccgtgattttgtttaaacaccaaagtgca |
101 |
Q |
| |
|
||||||||||||| ||| || |||||| ||||||| ||| ||||||||||||||| || | |||||||||| |
|
|
| T |
10734535 |
tgcatgtttggattaacaatgtgtttgacaaaatcacaatgacaccgtgattttgttgaagctccaaagtgca |
10734607 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 29 - 85
Target Start/End: Original strand, 38734219 - 38734275
Alignment:
| Q |
29 |
tgcatgtttggatcaacggtgagtttgaaaaaatcatgatggcaccgtgattttgtt |
85 |
Q |
| |
|
||||||||| ||| ||||||||||||| ||||||| |||||||| |||||||||| |
|
|
| T |
38734219 |
tgcatgtttagattgacggtgagtttgacaaaatcaccatggcaccatgattttgtt |
38734275 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University