View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF19915_high_53 (Length: 241)
Name: NF19915_high_53
Description: NF19915
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF19915_high_53 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 161; Significance: 5e-86; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 161; E-Value: 5e-86
Query Start/End: Original strand, 18 - 215
Target Start/End: Original strand, 10596521 - 10596718
Alignment:
| Q |
18 |
atgaatgatgccaaagagaatgtgacnnnnnnngactctaactcgatgagtaaacgacaatcaacatctccgcctaagggatccaagttacctcctgttt |
117 |
Q |
| |
|
|||||||||||||||||||||||||| ||||||||||||||||||||||||| | ||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
10596521 |
atgaatgatgccaaagagaatgtgacaaaaaaagactctaactcgatgagtaaacgacgaccaacatctccgcctaagggatccaagttacctcctgttt |
10596620 |
T |
 |
| Q |
118 |
gtctgagagttgatccattgccaaggaagaaaaatggaaatggaagttcaaggtctccaagtccacctgcttcaaaagaacactcgaaagcaacatct |
215 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||| ||||||||||||| |
|
|
| T |
10596621 |
gtctgagagttgatccattgccaaggaagaaaaatggaaatgggagttcaaggtctccaagtccacctgcttcaaaagaacacttgaaagcaacatct |
10596718 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University