View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF19915_high_58 (Length: 218)
Name: NF19915_high_58
Description: NF19915
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF19915_high_58 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 176; Significance: 5e-95; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 176; E-Value: 5e-95
Query Start/End: Original strand, 12 - 199
Target Start/End: Original strand, 31167164 - 31167351
Alignment:
| Q |
12 |
agtagcataggatagtcttcattgttgtgacaaaatttgttgaatgtgagttacttgagttatgttacatttagtctaaattggatctatttatagtgtg |
111 |
Q |
| |
|
||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||| |
|
|
| T |
31167164 |
agtagcataagatagtcttcattgttgtgacaaaatttgttgaatgtgagttacttgagttatgttacatttagtccaaattggatctatttatagtgtg |
31167263 |
T |
|
| Q |
112 |
ataaagtgggaatagaaatcctaatctttgttgttttggttttttgacattatttaataagtcaaatagggtccaatgatattttagg |
199 |
Q |
| |
|
|||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
31167264 |
ataaagtgggaatagaaatcctaaactttgttgttttggttttttgacattatttaataagtcaaatagggtccaatgatattttagg |
31167351 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University