View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF19915_high_61 (Length: 207)
Name: NF19915_high_61
Description: NF19915
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF19915_high_61 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 66; Significance: 2e-29; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 66; E-Value: 2e-29
Query Start/End: Original strand, 29 - 106
Target Start/End: Original strand, 52947830 - 52947907
Alignment:
| Q |
29 |
ttatattttgtttgttgtttgaatcaaaaaatctttgaatgttagtttgtaatgatgtaaaagagtagaatggatgtc |
106 |
Q |
| |
|
|||| |||||||||||||||||||||||||||||||||||| |||||| ||||||||||||||||||||||||||||| |
|
|
| T |
52947830 |
ttatcttttgtttgttgtttgaatcaaaaaatctttgaatgctagtttataatgatgtaaaagagtagaatggatgtc |
52947907 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University