View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF19915_low_33 (Length: 326)
Name: NF19915_low_33
Description: NF19915
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF19915_low_33 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 206; Significance: 1e-112; HSPs: 2)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 206; E-Value: 1e-112
Query Start/End: Original strand, 19 - 247
Target Start/End: Complemental strand, 32718258 - 32718029
Alignment:
| Q |
19 |
aactttcctcctcacatatgagacgctagcttccttacataatgacagggaataaatcaggtcaaaccccctttttaaggtgactgcaccaacccattca |
118 |
Q |
| |
|
|||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
32718258 |
aactttcctcctcacatatgagactctagcttccttacataatgacagggaataaatcaggtcaaaccccctttttaaggtgactgcaccaacccattca |
32718159 |
T |
 |
| Q |
119 |
tcactc-acaaaactgtatccttgcctctccccatatttctactaacacggtttaaaaaatgtaatcaaaactttcgattattctcaaattttcaaatca |
217 |
Q |
| |
|
||| || | |||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
32718158 |
tcagtccaaaaaactgtatccttgcctctccccatatttctactaacccggtttaaaaaatgtaatcaaaactttcgattattctcaaattttcaaatca |
32718059 |
T |
 |
| Q |
218 |
attcttgttaaagcttaatctacactattt |
247 |
Q |
| |
|
|||||||||||||||||||||||||||||| |
|
|
| T |
32718058 |
attcttgttaaagcttaatctacactattt |
32718029 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 266 - 307
Target Start/End: Complemental strand, 32717994 - 32717953
Alignment:
| Q |
266 |
gcaaaggagatttatagtgttgacgtctattttacagttttt |
307 |
Q |
| |
|
|||||||||||||||||| ||||||||||||||||||||||| |
|
|
| T |
32717994 |
gcaaaggagatttatagttttgacgtctattttacagttttt |
32717953 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University