View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF19915_low_36 (Length: 318)
Name: NF19915_low_36
Description: NF19915
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF19915_low_36 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 139; Significance: 1e-72; HSPs: 2)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 139; E-Value: 1e-72
Query Start/End: Original strand, 136 - 274
Target Start/End: Complemental strand, 44673132 - 44672994
Alignment:
| Q |
136 |
gtcttgtaagtatagcttgtaaaaagttgtgggatatttgatgtaccgaatgtgtgtaatatctcttctatgtataattgttaaattacatcattttatc |
235 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
44673132 |
gtcttgtaagtatagcttgtaaaaagttgtgggatatttgatgtaccgaatgtgtgtaatatctcttctatgtataattgttaaattacatcattttatc |
44673033 |
T |
|
| Q |
236 |
tctataatattggtgaaatttaagttttgttactgcctt |
274 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
44673032 |
tctataatattggtgaaatttaagttttgttactgcctt |
44672994 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 52; E-Value: 8e-21
Query Start/End: Original strand, 1 - 74
Target Start/End: Complemental strand, 44673269 - 44673194
Alignment:
| Q |
1 |
ttttatatgtgtttggtttgta-ttttaagacaatttttatgatttctt-aaacaatacacttgttagcgaaagcc |
74 |
Q |
| |
|
|||||||||||||||||||||| ||||||||||||||||||| |||||| ||||||||||||||||||| |||||| |
|
|
| T |
44673269 |
ttttatatgtgtttggtttgtacttttaagacaatttttatggtttctttaaacaatacacttgttagcaaaagcc |
44673194 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University