View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF19915_low_52 (Length: 274)
Name: NF19915_low_52
Description: NF19915
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF19915_low_52 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 249; Significance: 1e-138; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 249; E-Value: 1e-138
Query Start/End: Original strand, 1 - 257
Target Start/End: Original strand, 48001682 - 48001938
Alignment:
| Q |
1 |
ttcttcattattttattaggactcgtcacgaaatatcattggaacgaggtggagattctacatgtgatcatggagattatgaaaatgttgttgttgaaga |
100 |
Q |
| |
|
||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||| |
|
|
| T |
48001682 |
ttcttcattattttattaggactggtcacgaaatatcattggaacgaggtggagattctacatgtgatcatggagattatgaaaatgttgttggtgaaga |
48001781 |
T |
|
| Q |
101 |
aatctctgggacacaagctggtactgtctatagtggcgtaaccaatgtttctgagcttgagatgctgttgggagcatactttgtgcaaattggaggcaca |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
48001782 |
aatctctgggacacaagctggtactgtctatagtggcgtaaccaatgtttctgagcttgagatgctgttgggagcatactttgtgcaaattggaggcaca |
48001881 |
T |
|
| Q |
201 |
gtcaacaaaatatctgcggtacacaatcttttactccctctatttggtaaaacaatt |
257 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
48001882 |
gtcaacaaaatatctgcggtacacaatcttttactccctctatttggtaaaacaatt |
48001938 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University