View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF19915_low_58 (Length: 240)
Name: NF19915_low_58
Description: NF19915
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF19915_low_58 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 102; Significance: 9e-51; HSPs: 3)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 102; E-Value: 9e-51
Query Start/End: Original strand, 1 - 133
Target Start/End: Original strand, 27803719 - 27803852
Alignment:
| Q |
1 |
atcatctttt-ttcgactcttggtcaactcaatgatatttattttcatttttcccctaaggaattgttcatgaaagatggtttatgactgcccctagttt |
99 |
Q |
| |
|
|||||||||| ||||| |||| | ||||||||||||||||||||||||||| ||||||| ||||| |||||||||||||||||||||||||||||||||| |
|
|
| T |
27803719 |
atcatcttttattcgattcttagccaactcaatgatatttattttcattttccccctaaagaattattcatgaaagatggtttatgactgcccctagttt |
27803818 |
T |
 |
| Q |
100 |
gggatcgaattaggtggtagggttgtgatccatg |
133 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| |
|
|
| T |
27803819 |
gggatcgaattaggtggtagggttgtgatccatg |
27803852 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 77; E-Value: 7e-36
Query Start/End: Original strand, 131 - 227
Target Start/End: Original strand, 27803878 - 27803974
Alignment:
| Q |
131 |
atggaaatatttcacttttagcaatccatcattcgttaatttgattcctagccagacgttctattgtggattctcccggttcactagaaaacttggt |
227 |
Q |
| |
|
|||||||||||||| |||||||||||||||||| ||||||||||| |||||||| | |||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
27803878 |
atggaaatatttcagttttagcaatccatcatttgttaatttgatgcctagccacatgttctattgtggattctcccggttcactagaaaacttggt |
27803974 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #3
Raw Score: 45; E-Value: 9e-17
Query Start/End: Original strand, 1 - 120
Target Start/End: Original strand, 27800330 - 27800450
Alignment:
| Q |
1 |
atcatctttt-ttcgactcttggtcaactcaatgatatttattttcatttttcccctaaggaattgttcatgaaagatggtttatgactgcccctagttt |
99 |
Q |
| |
|
|||||||||| || || |||| |||||||| || |||||||| ||||||| ||| |||| || |||||||||||||||||||||| || |||||||||| |
|
|
| T |
27800330 |
atcatcttttctttgaatctttgtcaactcgataatatttatgttcatttctccactaaagagttgttcatgaaagatggtttataacaacccctagttt |
27800429 |
T |
 |
| Q |
100 |
gggatcgaattaggtggtagg |
120 |
Q |
| |
|
||||| |||| | ||||||| |
|
|
| T |
27800430 |
aggatcaaattcgctggtagg |
27800450 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University