View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF19915_low_59 (Length: 238)
Name: NF19915_low_59
Description: NF19915
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF19915_low_59 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 132; Significance: 1e-68; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 132; E-Value: 1e-68
Query Start/End: Original strand, 1 - 219
Target Start/End: Original strand, 37721397 - 37721618
Alignment:
| Q |
1 |
cgagaaagaaactccggcgtaaacaaaccaccataacgtaccgaacggaacatcgtcgccgtcggtaacgaaagaatcattctttctagcgaggaggttt |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
37721397 |
cgagaaagaaactccggcgtaaacaaaccaccataacgtaccgaacggaacatcgtcgccgtcggtaacgaaagaatcattctttctagcgaggaggttt |
37721496 |
T |
 |
| Q |
101 |
nnnnnnnnnnnnnnnnngttctgagggaacannnnnnngttatgaaattcagaattgtgaattttgttctttact---taataataatagcaactgacta |
197 |
Q |
| |
|
|||||||||||||| ||||||||||||||||||||||||||||||||||||| |||||||||||| ||||||||| |
|
|
| T |
37721497 |
agaagaagaagaagaaggttctgagggaacatttttttgttatgaaattcagaattgtgaattttgttctttacttaataataataatagtaactgacta |
37721596 |
T |
 |
| Q |
198 |
caaacatataccatgcggcatg |
219 |
Q |
| |
|
|||||||||||||||||||||| |
|
|
| T |
37721597 |
caaacatataccatgcggcatg |
37721618 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University