View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF19916_high_31 (Length: 264)
Name: NF19916_high_31
Description: NF19916
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF19916_high_31 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 130; Significance: 2e-67; HSPs: 2)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 130; E-Value: 2e-67
Query Start/End: Original strand, 12 - 141
Target Start/End: Original strand, 43396652 - 43396781
Alignment:
| Q |
12 |
agagaggacagtggtggtgcctgtgatgaatgtgaagagaagtgatatgtgtaagcttaagcaagctgcatggttgtttcatcatgctggtcttgatgct |
111 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
43396652 |
agagaggacagtggtggtgcctgtgatgaatgtgaagagaagtgatatgtgtaagcttaagcaagctgcatggttgtttcatcatgctggtcttgatgct |
43396751 |
T |
|
| Q |
112 |
acttcattgctcttcactgatgaggtcaca |
141 |
Q |
| |
|
|||||||||||||||||||||||||||||| |
|
|
| T |
43396752 |
acttcattgctcttcactgatgaggtcaca |
43396781 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 58; E-Value: 2e-24
Query Start/End: Original strand, 203 - 264
Target Start/End: Original strand, 43396843 - 43396904
Alignment:
| Q |
203 |
gttctataaataaaatttgggggaccaatttagtctccgagaagaaataataccaaactagt |
264 |
Q |
| |
|
|||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
43396843 |
gttctataaataaaatttggcggaccaatttagtctccgagaagaaataataccaaactagt |
43396904 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University