View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF19916_high_42 (Length: 242)
Name: NF19916_high_42
Description: NF19916
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF19916_high_42 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 144; Significance: 8e-76; HSPs: 2)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 144; E-Value: 8e-76
Query Start/End: Original strand, 1 - 206
Target Start/End: Complemental strand, 49254817 - 49254597
Alignment:
| Q |
1 |
catctttcacctcttgaaaaaatacacgccatgttatgcttcttgaacca---ccctctgtgtctttctctaacaaacctttatccatattttctagccc |
97 |
Q |
| |
|
||||||||||||||||||||||||||| |||||||||||||||||||||| |||||| |||||||||||||||||||||| ||||||||||||||||| |
|
|
| T |
49254817 |
catctttcacctcttgaaaaaatacaccccatgttatgcttcttgaaccagcaccctctctgtctttctctaacaaacctttttccatattttctagccc |
49254718 |
T |
|
| Q |
98 |
agaaaattgaata-------------cattaatattgggatttgaatacgttggtggaagttgagattattattgaaattggaataaacaatgttcagtt |
184 |
Q |
| |
|
||||||||||||| |||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
49254717 |
agaaaattgaatatgtgacaaagttacattaatattgg-atttgaatacgttggtggaagttgagattattattgaaattggaataaacaatgttcagtt |
49254619 |
T |
|
| Q |
185 |
cacatgtgatgctcgaacgaac |
206 |
Q |
| |
|
|||||||||||||||||||||| |
|
|
| T |
49254618 |
cacatgtgatgctcgaacgaac |
49254597 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 71; E-Value: 3e-32
Query Start/End: Original strand, 1 - 95
Target Start/End: Complemental strand, 49267079 - 49266985
Alignment:
| Q |
1 |
catctttcacctcttgaaaaaatacacgccatgttatgcttcttgaaccaccctctgtgtctttctctaacaaacctttatccatattttctagc |
95 |
Q |
| |
|
||||||||||||||||||||||||||| ||||||||||||||||||| |||| ||| ||||||||||||||||||| || ||||||||||||||| |
|
|
| T |
49267079 |
catctttcacctcttgaaaaaatacaccccatgttatgcttcttgaatcaccttctctgtctttctctaacaaacccttttccatattttctagc |
49266985 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University