View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF19916_low_20 (Length: 369)
Name: NF19916_low_20
Description: NF19916
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF19916_low_20 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 280; Significance: 1e-157; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 280; E-Value: 1e-157
Query Start/End: Original strand, 61 - 352
Target Start/End: Complemental strand, 31821493 - 31821202
Alignment:
| Q |
61 |
gttaacacaacgtctttcaaatcaaccggttcttggatttcctcagaatccttaacctcagagtttttgccatctctttgaacataattgtctggttcaa |
160 |
Q |
| |
|
|||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||| |
|
|
| T |
31821493 |
gttaacacaacgtctttcaaattaaccggttcttggatttcctcagaatccttaacctcagagtttttgccatctctttgaacagaattgtctggttcag |
31821394 |
T |
|
| Q |
161 |
atttttcttcttggatttcttgagttttgtatttgatactcgagaatgaaaactccgctattgacttaacgtcttcattgtacatgaagacaccaaagag |
260 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
31821393 |
atttttcttcttggatttcttgagttttgtatttgatactcgagaatgaaaactccgctattgacttaacgtcttcattgtacatgaagacaccaaagag |
31821294 |
T |
|
| Q |
261 |
gaatagggagaaaacaacaaagaaaatggaaatgcttttgttatttttgcctttcattgtcacagtttccgagtagaaaatatttttcttgc |
352 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
31821293 |
gaatagggagaaaacaacaaagaaaatggaaatgcttttgttatttttgcctttcattgtcacagtttccgagtagaaaatatttttcttgc |
31821202 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5 (Bit Score: 36; Significance: 0.00000000003; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 36; E-Value: 0.00000000003
Query Start/End: Original strand, 205 - 260
Target Start/End: Complemental strand, 35688129 - 35688074
Alignment:
| Q |
205 |
aatgaaaactccgctattgacttaacgtcttcattgtacatgaagacaccaaagag |
260 |
Q |
| |
|
|||| |||||| |||||||| ||||||||||||||||| ||||||||| ||||||| |
|
|
| T |
35688129 |
aatggaaactcagctattgatttaacgtcttcattgtatatgaagacagcaaagag |
35688074 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University