View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF19916_low_22 (Length: 336)
Name: NF19916_low_22
Description: NF19916
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF19916_low_22 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 285; Significance: 1e-160; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 285; E-Value: 1e-160
Query Start/End: Original strand, 1 - 325
Target Start/End: Original strand, 37701259 - 37701584
Alignment:
| Q |
1 |
tggcattgttatgtattctgtgcgcataataactacatggtcatgtaggctcaacccactagnnnnnnntctgaataatacaagagccaaatgtattcat |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||| ||||||||||||||||||||||| ||||||| |
|
|
| T |
37701259 |
tggcattgttatgtattctgtgcgcataataactacattgtcatgtaggctcaacccactagccccccctctgaataatacaagagccaaatttattcat |
37701358 |
T |
 |
| Q |
101 |
gaaattattatataccttggcaaacactgctacaaattttgttaggtaatgagtttatatggtcccaaaagatccgtgtaatgcctgaagaaatttaaca |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
37701359 |
gaaattattatataccttggcaaacactgctacaaattttgttaggtaatgagtttatatggtcccaaaagatccgtgtaatgcctgaagaaatttaaca |
37701458 |
T |
 |
| Q |
201 |
tgaagatgcaaatctaaacaactggcataattcatacatgttgattattaaattactcttgctcccgaattaaattac-ttttttgtcggtaagcagttc |
299 |
Q |
| |
|
|||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||| |
|
|
| T |
37701459 |
tgaagatgcaaatcaaaacaactggcataattcatacatgttgattattaaattactcttgctcccgaattaaattactttttttgtcggtaagcagttc |
37701558 |
T |
 |
| Q |
300 |
aaatttgtaggaactagtagcaagta |
325 |
Q |
| |
|
|||||||||||||||||||||||||| |
|
|
| T |
37701559 |
aaatttgtaggaactagtagcaagta |
37701584 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University