View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF19916_low_29 (Length: 285)
Name: NF19916_low_29
Description: NF19916
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF19916_low_29 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 177; Significance: 2e-95; HSPs: 2)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 177; E-Value: 2e-95
Query Start/End: Original strand, 93 - 273
Target Start/End: Complemental strand, 4893285 - 4893105
Alignment:
| Q |
93 |
tgcttcttatgggatcactgtattatgctgcaactattacgtttgcatcgataatatactggagaacttcgcctatttccattgctgcaatctgtaattt |
192 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||| |
|
|
| T |
4893285 |
tgcttcttatgggatcactgtattatgctgcaactattacgtttgcatcgataatatactggagaacttcgcctgtttccattgctgcaatctgtaattt |
4893186 |
T |
|
| Q |
193 |
gtgtgcaggagatggtatggctgatatcgttggaaggagatttggtggtaaaaagttaccttacaacaaaaacaagtccta |
273 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
4893185 |
gtgtgcaggagatggtatggctgatatcgttggaaggagatttggtggtaaaaagttaccttacaacaaaaacaagtccta |
4893105 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 164; E-Value: 1e-87
Query Start/End: Original strand, 94 - 277
Target Start/End: Complemental strand, 4873629 - 4873446
Alignment:
| Q |
94 |
gcttcttatgggatcactgtattatgctgcaactattacgtttgcatcgataatatactggagaacttcgcctatttccattgctgcaatctgtaatttg |
193 |
Q |
| |
|
|||||||| ||||||||||||||||| |||||||||| |||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||| |
|
|
| T |
4873629 |
gcttcttaggggatcactgtattatgttgcaactattgtgtttgcatcgataatatactggagaacttcgcctgtttccattgctgcaatctgtaatttg |
4873530 |
T |
|
| Q |
194 |
tgtgcaggagatggtatggctgatatcgttggaaggagatttggtggtaaaaagttaccttacaacaaaaacaagtcctatgct |
277 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
4873529 |
tgtgcaggagatggtatggctgatatcgttggaaggagatttggtggtaaaaagttaccttacaacaaaaacaagtcctatgct |
4873446 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3 (Bit Score: 67; Significance: 8e-30; HSPs: 2)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 67; E-Value: 8e-30
Query Start/End: Original strand, 95 - 209
Target Start/End: Complemental strand, 26330978 - 26330864
Alignment:
| Q |
95 |
cttcttatgggatcactgtattatgctgcaactattacgtttgcatcgataatatactggagaacttcgcctatttccattgctgcaatctgtaatttgt |
194 |
Q |
| |
|
||||||| |||| |||||||||||||||| |||||||| || || || || ||||||||||||||||| ||||||||||||||||| || |||||| ||| |
|
|
| T |
26330978 |
cttcttaggggaccactgtattatgctgctactattactttggcgtccatgatatactggagaacttcccctatttccattgctgcgatatgtaatctgt |
26330879 |
T |
|
| Q |
195 |
gtgcaggagatggta |
209 |
Q |
| |
|
||||||||||||||| |
|
|
| T |
26330878 |
gtgcaggagatggta |
26330864 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 36; E-Value: 0.00000000003
Query Start/End: Original strand, 206 - 277
Target Start/End: Complemental strand, 26330693 - 26330622
Alignment:
| Q |
206 |
ggtatggctgatatcgttggaaggagatttggtggtaaaaagttaccttacaacaaaaacaagtcctatgct |
277 |
Q |
| |
|
|||||||| || || || |||||||| ||||| || |||| |||||||||||||||||||||||||||||| |
|
|
| T |
26330693 |
ggtatggccgacattgtgggaaggaggtttggcagtgaaaaattaccttacaacaaaaacaagtcctatgct |
26330622 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8 (Bit Score: 39; Significance: 0.0000000000004; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 39; E-Value: 0.0000000000004
Query Start/End: Original strand, 23 - 65
Target Start/End: Original strand, 19996828 - 19996870
Alignment:
| Q |
23 |
ctatatatagctgtttgtattgaaccttcaatctaatgagaaa |
65 |
Q |
| |
|
||||||||||||| ||||||||||||||||||||||||||||| |
|
|
| T |
19996828 |
ctatatatagctgcttgtattgaaccttcaatctaatgagaaa |
19996870 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University