View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF19916_low_35 (Length: 261)
Name: NF19916_low_35
Description: NF19916
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF19916_low_35 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 227; Significance: 1e-125; HSPs: 2)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 227; E-Value: 1e-125
Query Start/End: Original strand, 15 - 245
Target Start/End: Complemental strand, 7892406 - 7892176
Alignment:
| Q |
15 |
atgaagggatgatagtgtttggaattcctttgtattggaatatagccgtagcggttttgttatcaactgagagtggtgcatccatgaaagttcttgtagc |
114 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
7892406 |
atgaagggatgatagtgtttggaattcctttgtattggaatatagccgtagcggttttgttatcaactgagagtggtgcatccatgaaagttcttgtagc |
7892307 |
T |
|
| Q |
115 |
aacgaagtatctgcttggaattttgtttgctttgactagaacatttgtggtttgaccaggaccaattagaatggattgtgttgtgaatggttttgtgtaa |
214 |
Q |
| |
|
|| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
7892306 |
aatgaagtatctgcttggaattttgtttgctttgactagaacatttgtggtttgaccaggaccaattagaatggattgtgttgtgaatggttttgtgtaa |
7892207 |
T |
|
| Q |
215 |
actgcatcaacttcaactactgtcatgttgt |
245 |
Q |
| |
|
||||||||||||||||||||||||||||||| |
|
|
| T |
7892206 |
actgcatcaacttcaactactgtcatgttgt |
7892176 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 46; E-Value: 3e-17
Query Start/End: Original strand, 152 - 245
Target Start/End: Complemental strand, 7902542 - 7902449
Alignment:
| Q |
152 |
agaacatttgtggtttgaccaggaccaattagaatggattgtgttgtgaatggttttgtgtaaactgcatcaacttcaactactgtcatgttgt |
245 |
Q |
| |
|
||||| |||||||||||||||||| ||||||| || | || || |||||||||||||| ||||| |||||||| || |||||||||||||||| |
|
|
| T |
7902542 |
agaacgtttgtggtttgaccaggagcaattagtatagcctgagtggtgaatggttttgtataaacagcatcaacctccactactgtcatgttgt |
7902449 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University