View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF19916_low_37 (Length: 259)
Name: NF19916_low_37
Description: NF19916
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF19916_low_37 |
 | |
|
Alignment Details
Target: chr8 (Bit Score: 206; Significance: 1e-113; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 206; E-Value: 1e-113
Query Start/End: Original strand, 1 - 242
Target Start/End: Complemental strand, 40282429 - 40282188
Alignment:
| Q |
1 |
tgcttcagctgagttcttccatggaaatcttctgtctctcttctcatgcagatagaattcataagcttcctggacaaccccacataggctttcaacactt |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
40282429 |
tgcttcagctgagttcttccatggaaatcttctgtctctcttctcatgcagatagaattcataagcttcctggacaaccccacataggctttcaacactt |
40282330 |
T |
|
| Q |
101 |
ctcaggatatgttacggttgatgnnnnnnnncacagatatctcttttactattttgttgaatcagaaactgatccatcttcaaagcctttagtcctttgg |
200 |
Q |
| |
|
||||||||||||||| ||||||| | |||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||| |
|
|
| T |
40282329 |
ctcaggatatgttacagttgatgaaaaaaaacgcagatatctcttttactattttgttgaatcagaaactggtccatcttcaaagcctttagtcctttgg |
40282230 |
T |
|
| Q |
201 |
ctcaatggaggtctccaatctctaacttgccacaacttcact |
242 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
40282229 |
ctcaatggaggtctccaatctctaacttgccacaacttcact |
40282188 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3 (Bit Score: 37; Significance: 0.000000000006; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 37; E-Value: 0.000000000006
Query Start/End: Original strand, 144 - 208
Target Start/End: Complemental strand, 45130146 - 45130082
Alignment:
| Q |
144 |
ttttactattttgttgaatcagaaactgatccatcttcaaagcctttagtcctttggctcaatgg |
208 |
Q |
| |
|
|||||||| |||| |||||||||||||||||| |||||||| ||| | || |||||||||||||| |
|
|
| T |
45130146 |
ttttactactttgctgaatcagaaactgatccttcttcaaaacctcttgttctttggctcaatgg |
45130082 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University